Ticket #4915: bugdump.txt

File bugdump.txt, 25.5 KB (added by drvitek, 4 years ago)

Dump of command line history at time of bug

Line 
1[3 of 9] Compiling InputHandlers    ( InputHandlers.hs, interpreted )
2[6 of 9] Compiling Iterators        ( Iterators.hs, interpreted )
3[7 of 9] Compiling OutputHandlers   ( OutputHandlers.hs, interpreted )
4[8 of 9] Compiling AminoAcids       ( AminoAcids.hs, interpreted )
5[9 of 9] Compiling Main             ( importer.hs, interpreted )
6Ok, modules loaded: AminoAcids, TRNA, Utilities, Options, Iterators, InputHandlers, OutputHandlers, GeneInput, Main.
7
8ghci> diceAt '>' $ readFile inputs\genes.fasta
9
10<interactive>:1:28: parse error on input `\'
11ghci> :m + System.IO
12ghci> diceAt '>' $ readFile "inputs\genes.fasta"
13
14<interactive>:1:30:
15    lexical error in string/character literal at character 'g'
16ghci> diceAt '>' $ readFile "inputs\\genes.fasta"
17
18<interactive>:1:13:
19    Couldn't match expected type `[String]'
20           against inferred type `IO String'
21    In the second argument of `($)', namely
22        `readFile "inputs\\genes.fasta"'
23    In the expression: diceAt '>' $ readFile "inputs\\genes.fasta"
24    In the definition of `it':
25        it = diceAt '>' $ readFile "inputs\\genes.fasta"
26ghci> slices <- fmap (diceAt . lines) $ readFile "inputs\\genes.fasta"
27
28<interactive>:1:25:
29    Couldn't match expected type `Char'
30           against inferred type `[String]'
31    In the second argument of `(.)', namely `lines'
32    In the first argument of `fmap', namely `(diceAt . lines)'
33    In the first argument of `($)', namely `fmap (diceAt . lines)'
34ghci> slices <- fmap ((diceAt '>') . lines) $ readFile "inputs\\genes.fasta"
35Loading package array-0.3.0.1 ... linking ... done.
36Loading package containers-0.3.0.0 ... linking ... done.
37ghci> :t slices
38slices :: [(String, [String])]
39ghci> head slices
40("> prfB",["agaaaucagaccauguuugaaauuaauccgguaaauaaucgcauucaggaccucacggaacgcuccgacguucuuaggggguaucuuugacuacgacgccaaga
41aagagcgucuggaagaaguaaacgccgagcuggaacagccggaugucuggaacgaacccgaacgcgcacaggcgcuggguaaagagcguuccucccucgaagccguugucgacacc
42cucgaccaaaugaaacaggggcuggaagauguuucuggucugcuggaacuggcuguagaagcugacgacgaagaaaccuuuaacgaagccguugcugaacucgacgcccuggaaga
43aaaacuggcgcagcuugaguuccgccguauguucucuggcgaauaugacagcgccgacugcuaccucgauauucaggcggggucuggcgguacggaagcacaggacugggcgagca
44ugcuugagcguauguaucugcgcugggcagaaucgcgugguuucaaaacugaaaucaucgaagagucggaaggugaaguggcggguauuaaauccgugacgaucaaaaucuccggc
45gauuacgcuuacggcuggcugcguacagaaaccggcguucaccgccuggugcguaaaagcccguuugacuccggcggucgucgccacacgucguucagcuccgcguuuguuuaucc
46ggaaguugaugaugauauugauaucgaaaucaacccggcggaucugcgcauugacguuuaucgcacguccggcgcgggcggucagcacguuaaccguaccgaaucugcggugcgua
47uuacccacaucccgaccgggaucgugacccagugccagaacgaccguucccagcacaagaacaaagaucaggccaugaagcagaugaaagcgaagcuuuaugaacuggagaugcag
48aagaaaaaugccgagaaacaggcgauggaagauaacaaauccgacaucggcuggggcagccagauucguucuuauguccuugaugacucccgcauuaaagaucugcgcaccggggu
49agaaacccgcaacacgcaggccgugcuggacggcagccuggaucaauuuaucgaagcaaguuugaaagcaggguuauga"])
50ghci> head $ snd $ head slices
51"agaaaucagaccauguuugaaauuaauccgguaaauaaucgcauucaggaccucacggaacgcuccgacguucuuaggggguaucuuugacuacgacgccaagaaagagcgucug
52gaagaaguaaacgccgagcuggaacagccggaugucuggaacgaacccgaacgcgcacaggcgcuggguaaagagcguuccucccucgaagccguugucgacacccucgaccaaau
53gaaacaggggcuggaagauguuucuggucugcuggaacuggcuguagaagcugacgacgaagaaaccuuuaacgaagccguugcugaacucgacgcccuggaagaaaaacuggcgc
54agcuugaguuccgccguauguucucuggcgaauaugacagcgccgacugcuaccucgauauucaggcggggucuggcgguacggaagcacaggacugggcgagcaugcuugagcgu
55auguaucugcgcugggcagaaucgcgugguuucaaaacugaaaucaucgaagagucggaaggugaaguggcggguauuaaauccgugacgaucaaaaucuccggcgauuacgcuua
56cggcuggcugcguacagaaaccggcguucaccgccuggugcguaaaagcccguuugacuccggcggucgucgccacacgucguucagcuccgcguuuguuuauccggaaguugaug
57augauauugauaucgaaaucaacccggcggaucugcgcauugacguuuaucgcacguccggcgcgggcggucagcacguuaaccguaccgaaucugcggugcguauuacccacauc
58ccgaccgggaucgugacccagugccagaacgaccguucccagcacaagaacaaagaucaggccaugaagcagaugaaagcgaagcuuuaugaacuggagaugcagaagaaaaaugc
59cgagaaacaggcgauggaagauaacaaauccgacaucggcuggggcagccagauucguucuuauguccuugaugacucccgcauuaaagaucugcgcaccgggguagaaacccgca
60acacgcaggccgugcuggacggcagccuggaucaauuuaucgaagcaaguuugaaagcaggguuauga"
61ghci> :t (head $ snd $ head slices)
62(head $ snd $ head slices) :: String
63ghci> peels <- fmap ((diceAt '>') . lines) $ readFile "inputs\\energies.fasta"
64ghci> :t peels
65peels :: [(String, [String])]
66ghci> head peels
67("> prfB",["0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.500 0.000
680.000 0.000 0.000 0.000 0.000 0.000 -3.100 0.000 0.000 -1.000 -0.500 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
69 0.000 0.000 0.000 -0.800 0.000 -1.800 0.000 0.000 -4.100 0.000 0.000 0.000 -0.800 0.000 -1.000 0.000 0.000 -3.300 0
70.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.700 -1.400 -3.300
71 -9.500 0.000 -2.800 -1.400 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.
72000 0.000 -0.800 0.000 0.000 0.000 -0.800 0.000 -0.000 0.000 0.000 -1.600 -0.200 0.000 -0.500 -0.800 0.000 -0.700 -0
73.800 0.000 -3.000 0.000 0.000 0.000 -0.300 0.000 0.000 -0.300 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 -1.700 -0.8
7400 0.000 -0.700 0.000 0.000 -3.000 0.000 0.000 0.000 -1.700 0.000 -1.000 0.000 0.000 -3.300 0.000 -0.500 -0.800 0.00
750 -0.700 0.000 -0.900 -3.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.
76000 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000 -0.700 -3.500 0.000 -2.100 -1.400 0.000 0.000 0.000 0.00
770 -1.600 -0.200 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.0
7800 -0.300 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.
79000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 -1.400 -3.300 0.000 -3.700 -1.400 -0.700 -1.
80700 0.000 -3.000 0.000 0.000 0.000 -0.300 0.000 0.000 -3.400 0.000 0.000 -2.800 0.000 0.000 -0.700 0.000 -0.500 -0.8
8100 0.000 -0.700 0.000 0.000 -3.000 0.000 0.000 -0.700 0.000 0.000 -0.700 -0.800 0.000 0.000 0.000 0.000 0.000 -1.400
82 0.000 0.000 -0.900 0.000 0.000 -0.900 0.000 0.000 -0.800 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.0
8300 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.
84000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 -0.800 0.000 -0.700 -0.800 0.000 -3.000 0.000 0.000 0.00
850 -0.300 0.000 -0.500 0.000 0.000 -0.700 0.000 0.000 -0.700 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 -1.400
860.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.000 -0.900
870.000 0.000 -0.700 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000
88 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800
89 0.000 -2.800 -1.800 -1.400 -5.500 0.000 -2.800 -1.400 0.000 -0.700 0.000 0.000 -3.100 0.000 0.000 -1.000 0.000 -1.0
9000 0.000 0.000 -3.300 0.000 0.000 0.000 -0.800 0.000 -1.800 0.000 -0.500 -4.100 0.000 -0.700 -1.400 0.000 -2.100 -1.
91400 0.000 -1.700 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 -0.300 0.000 0.000
920.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.000 -0.700 -1.400 -0.800 -2.100 -1.400 0.000 0.000 0.000 0.
93000 0.000 0.000 -4.600 0.000 0.000 -2.800 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 -0.500 0.000
94 0.000 -0.400 0.000 0.000 0.000 -0.900 0.000 0.000 -0.800 0.000 0.000 0.000 0.000 -1.600 -0.800 0.000 -1.000 0.000 0
95.000 -3.300 -8.100 0.000 0.000 -3.200 0.000 -2.900 0.000 0.000 -0.700 0.000 0.000 -1.000 -3.500 0.000 -2.400 -1.400
96-0.500 0.000 0.000 0.000 0.000 0.000 0.000 -3.900 0.000 0.000 -4.100 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.00
970 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.800 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.00
980 0.000 0.000 0.000 -1.000 -0.500 0.000 -1.000 -0.700 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 -0.800 0.000 0.000
990.000 0.000 0.000 0.000 0.000 0.000 -1.000 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
1000.000 -4.600 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 -1.400 0.00
1010 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.900 0.000 0.000 -3.100 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.0
10200 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
103 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.000 0.000 -0.800 0.000 -1.000 0.000 0.000 -3.300 -2.300 0.
104000 0.000 -2.300 0.000 0.000 -2.300 0.000 0.000 0.000 0.000 0.000 -2.300 0.000 -0.300 0.000 0.000 0.000 -0.900 0.000
105 -0.500 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 -4.000 0.000 -1.000 0.000 0.000 -3.
106300 0.000 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.000 0.000 0.
107000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 0.000 0.000 -1.000 0.000 -1.000 -2.900 0.000 -2.400 -3.10
1080 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 -0.5
10900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -4.900 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.0
11000 0.000 0.000 -0.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 -4.000 -1.000 -1.400 0.000
111-2.400 -3.700 -3.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.500 0.000 0.000 0.000 -0.800 0.000 0.000 0.000 -0.
112900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.800 0.000 0.0
11300 0.000 0.000 0.000 -0.000 -4.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000
1140.000 0.000 0.000 -1.700 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 -0.200 0.000 0.00
1150 0.000 0.000 -0.300 -1.400 0.000 0.000 0.000 0.000 -0.500 -0.800 0.000 -1.700 0.000 0.000 -4.700 0.000 0.000 -0.800
116 0.000 0.000 -0.800 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 -0.900 0.000 -0.800 0.000 0.000 -1.700 0.
117000 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 -0.800 0.000 -0.700 -1.700 0.000 -3.000 0.000 0.000 0.000 -0.3
11800 -0.500 0.000 0.000 0.000 0.000 -0.900 0.000 -0.400 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 -0.500 0.000 -1.000
119 -0.700 -1.400 -3.100 0.000 -2.800 -1.400 0.000 -2.700 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0
120.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.300 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0
121.000 0.000 0.000 0.000 0.000 0.000 0.000 -4.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 0.000 0.000 0.000 0.000 0
122.000 0.000 0.000 -1.000 -1.400 -5.500 0.000 -2.800 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.00
1230 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000 -0.500 -0.800 0.000 -0.700 0.000 0
124.000 -3.000 -1.000 0.000 0.000 -1.000 0.000 -0.500 -4.000 0.000 -0.700 0.000 0.000 -3.000 0.000 0.000 -0.300 0.000 0
125.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 -1.400 0.000 -0.000 0.000 0.000 0.000
126 0.000 0.000 -1.500 0.000 -1.800 -3.500 0.000"])
127ghci> let peel1 = head peels
128ghci> :t peel1
129peel1 :: (String, [String])
130ghci> length $ snd peel1
1311
132ghci> length $ words $ snd peel1
133
134<interactive>:1:17:
135    Couldn't match expected type `Char' against inferred type `[Char]'
136      Expected type: String
137      Inferred type: [String]
138    In the second argument of `($)', namely `snd peel1'
139    In the second argument of `($)', namely `words $ snd peel1'
140ghci> :t snd peel1
141snd peel1 :: [String]
142ghci> :info Data.List.intersperse
143Data.List.intersperse :: a -> [a] -> [a]        -- Defined in Data.List
144ghci> joinEng peel1
145("> prfB",[0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,-0.5,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-3.1,0.0,0.
1460,-1.0,-0.5,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.8,0.0,-1.8,0.0,0.0,-4.1,0.0,0.0,0.0,-0.8,0.0,-1.0,0.0,0.0
147,-3.3,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.7,-1.4,-3.3,-9.5,0.0,-2.8,-1.4,0.0,0.0,-1.
1484,0.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.8,0.0,0.0,0.0,-0.8,0.0,-0.0,0.0,0.0,-1.6,-0.2,0.0,-0.5,-0.
1498,0.0,-0.7,-0.8,0.0,-3.0,0.0,0.0,0.0,-0.3,0.0,0.0,-0.3,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,-1.7,-0.8,0.0,-0.7,0.0,0.0,-3.0,
1500.0,0.0,0.0,-1.7,0.0,-1.0,0.0,0.0,-3.3,0.0,-0.5,-0.8,0.0,-0.7,0.0,-0.9,-3.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0
151,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.8,0.0,0.0,-1.8,0.0,0.0,-0.7,-3.5,0.0,-2.1,-1.4,0.0,0.0,0.0,0.0,-1.6,-0.2,0.0,0.0
152,0.0,0.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.9
153,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.8,-1.4,-3.3,0.0,-3.7,-1.4,-0.7,-1.7,0.0,-3.0,0.
1540,0.0,0.0,-0.3,0.0,0.0,-3.4,0.0,0.0,-2.8,0.0,0.0,-0.7,0.0,-0.5,-0.8,0.0,-0.7,0.0,0.0,-3.0,0.0,0.0,-0.7,0.0,0.0,-0.7,
155-0.8,0.0,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,-0.9,0.0,0.0,-0.9,0.0,0.0,-0.8,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,0.0,0.0,0.0,0.0,-0
156.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.5,-0.8,
1570.0,-0.7,-0.8,0.0,-3.0,0.0,0.0,0.0,-0.3,0.0,-0.5,0.0,0.0,-0.7,0.0,0.0,-0.7,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,-1.4,0.0
158,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.5,0.0,0.0,-0.9,0.0,0.0,-0.7,0.0,0.0,-1.4,0.0,0.0,0.0,0.0
159,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.8,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.8,
1600.0,-2.8,-1.8,-1.4,-5.5,0.0,-2.8,-1.4,0.0,-0.7,0.0,0.0,-3.1,0.0,0.0,-1.0,0.0,-1.0,0.0,0.0,-3.3,0.0,0.0,0.0,-0.8,0.0,
161-1.8,0.0,-0.5,-4.1,0.0,-0.7,-1.4,0.0,-2.1,-1.4,0.0,-1.7,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,-0.3,0
162.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.5,0.0,0.0,-0.7,-1.4,-0.8,-2.1,-1.4,0.0,0.0,0.0,0.0,0.0,0.0,-4.6,0.0,0.0,-2.8,0
163.0,0.0,-0.7,0.0,0.0,0.0,0.0,0.0,-1.4,0.0,-0.5,0.0,0.0,-0.4,0.0,0.0,0.0,-0.9,0.0,0.0,-0.8,0.0,0.0,0.0,0.0,-1.6,-0.8,0
164.0,-1.0,0.0,0.0,-3.3,-8.1,0.0,0.0,-3.2,0.0,-2.9,0.0,0.0,-0.7,0.0,0.0,-1.0,-3.5,0.0,-2.4,-1.4,-0.5,0.0,0.0,0.0,0.0,0.
1650,0.0,-3.9,0.0,0.0,-4.1,0.0,0.0,0.0,0.0,0.0,-0.5,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-2.8,0.0,0.0,-1.0,0.0,0.0,0.0,0
166.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.0,-0.5,0.0,-1.0,-0.7,0.0,0.0,-0.7,0.0,0.0,0.0,0.0,-0.8,0.0,0.0,0.0,0.0,0.0,0.0,0.0
167,0.0,-1.0,0.0,0.0,-1.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-4.6,0.0,0.0,-0.7,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
168,0.0,-0.2,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-2.9,0.0,0.0,-3.1,0.0,0.0,-1.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.
1690,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,0.0,0.0,0.0,0.0,-0.8,0.0,
170-1.0,0.0,0.0,-3.3,-2.3,0.0,0.0,-2.3,0.0,0.0,-2.3,0.0,0.0,0.0,0.0,0.0,-2.3,0.0,-0.3,0.0,0.0,0.0,-0.9,0.0,-0.5,0.0,0.0
171,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.0,-4.0,0.0,-1.0,0.0,0.0,-3.3,0.0,0.0,0.0,0.0,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.
1720,-0.3,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.0,0.0,0.0,-1.0,0.0,-1.0,-2.9,0.0,-2.4,-3.1,0.0,0.0
173,-1.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.9,-0.5,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-4.9,0.0
174,0.0,-1.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.4,0.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,-4.0,-1.0,-1.4,0.0,-2.4,
175-3.7,-3.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.5,0.0,0.0,0.0,-0.8,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0
176,0.0,0.0,0.0,0.0,0.0,0.0,-0.8,0.0,0.0,0.0,0.0,0.0,-0.0,-4.0,0.0,0.0,0.0,0.0,0.0,-0.2,0.0,-1.8,0.0,0.0,-1.8,0.0,0.0,0
177.0,0.0,0.0,-1.7,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,-0.2,0.0,0.0,0.0,0.0,-0.3,-1.4,0.0,0.0,0.0,0.0,-0.
1785,-0.8,0.0,-1.7,0.0,0.0,-4.7,0.0,0.0,-0.8,0.0,0.0,-0.8,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,0.0,0.0,-0.9,0.0,-0.8,0.0,0.0,-1
179.7,0.0,0.0,0.0,0.0,0.0,-1.8,0.0,0.0,-1.8,-0.8,0.0,-0.7,-1.7,0.0,-3.0,0.0,0.0,0.0,-0.3,-0.5,0.0,0.0,0.0,0.0,-0.9,0.0,
180-0.4,0.0,0.0,0.0,0.0,0.0,0.0,-1.0,-0.5,0.0,-1.0,-0.7,-1.4,-3.1,0.0,-2.8,-1.4,0.0,-2.7,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.
1810,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-2.3,0.0,0.0,-1.4,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,
182-4.0,0.0,0.0,0.0,0.0,0.0,-0.2,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.0,-1.4,-5.5,0.0,-2.8,-1.4,0.0,0.0,0.0,0.0,0.0,0.0,0
183.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-1.8,0.0,0.0,-1.8,0.0,0.0,-0.5,-0.8,0.0,-0.7,0.0,0.0,-3.0,-1.0,0.0,0.0,-1
184.0,0.0,-0.5,-4.0,0.0,-0.7,0.0,0.0,-3.0,0.0,0.0,-0.3,0.0,0.0,0.0,-0.9,0.0,0.0,0.0,0.0,0.0,0.0,0.0,0.0,-0.3,0.0,-1.4,0
185.0,-0.0,0.0,0.0,0.0,0.0,0.0,-1.5,0.0,-1.8,-3.5,0.0])
186ghci> :t joinEng peel1
187joinEng peel1 :: (String, [Double])
188ghci> tail []
189*** Exception: Prelude.tail: empty list
190ghci> :r
191[2 of 9] Compiling GeneInput        ( GeneInput.hs, interpreted )
192Ok, modules loaded: AminoAcids, TRNA, Utilities, Options, Iterators, InputHandlers, OutputHandlers, GeneInput, Main.
193
194ghci> :t peel1
195
196<interactive>:1:0: Not in scope: `peel1'
197ghci> peels <- fmap ((diceAt '>') . lines) $ readFile "inputs\\energies.fasta"
198ghci> let peel1 = head peels
199ghci> :t peel1
200peel1 :: (String, [String])
201ghci> peel1
202("rfB",["0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.0
20300 0.000 0.000 0.000 0.000 0.000 -3.100 0.000 0.000 -1.000 -0.500 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.
204000 0.000 0.000 -0.800 0.000 -1.800 0.000 0.000 -4.100 0.000 0.000 0.000 -0.800 0.000 -1.000 0.000 0.000 -3.300 0.00
2050 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.700 -1.400 -3.300 -9
206.500 0.000 -2.800 -1.400 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000
207 0.000 -0.800 0.000 0.000 0.000 -0.800 0.000 -0.000 0.000 0.000 -1.600 -0.200 0.000 -0.500 -0.800 0.000 -0.700 -0.80
2080 0.000 -3.000 0.000 0.000 0.000 -0.300 0.000 0.000 -0.300 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 -1.700 -0.800
2090.000 -0.700 0.000 0.000 -3.000 0.000 0.000 0.000 -1.700 0.000 -1.000 0.000 0.000 -3.300 0.000 -0.500 -0.800 0.000 -
2100.700 0.000 -0.900 -3.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
211 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000 -0.700 -3.500 0.000 -2.100 -1.400 0.000 0.000 0.000 0.000 -
2121.600 -0.200 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000
213-0.300 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000
214 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 -1.400 -3.300 0.000 -3.700 -1.400 -0.700 -1.700
215 0.000 -3.000 0.000 0.000 0.000 -0.300 0.000 0.000 -3.400 0.000 0.000 -2.800 0.000 0.000 -0.700 0.000 -0.500 -0.800
2160.000 -0.700 0.000 0.000 -3.000 0.000 0.000 -0.700 0.000 0.000 -0.700 -0.800 0.000 0.000 0.000 0.000 0.000 -1.400 0.
217000 0.000 -0.900 0.000 0.000 -0.900 0.000 0.000 -0.800 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.000
2180.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000
219 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 -0.800 0.000 -0.700 -0.800 0.000 -3.000 0.000 0.000 0.000 -
2200.300 0.000 -0.500 0.000 0.000 -0.700 0.000 0.000 -0.700 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 -1.400 0.0
22100 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.000 -0.900 0.0
22200 0.000 -0.700 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.
223000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 0.
224000 -2.800 -1.800 -1.400 -5.500 0.000 -2.800 -1.400 0.000 -0.700 0.000 0.000 -3.100 0.000 0.000 -1.000 0.000 -1.000
2250.000 0.000 -3.300 0.000 0.000 0.000 -0.800 0.000 -1.800 0.000 -0.500 -4.100 0.000 -0.700 -1.400 0.000 -2.100 -1.400
226 0.000 -1.700 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 -0.300 0.000 0.000 0.0
22700 0.000 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.000 -0.700 -1.400 -0.800 -2.100 -1.400 0.000 0.000 0.000 0.000
228 0.000 0.000 -4.600 0.000 0.000 -2.800 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 -0.500 0.000 0.
229000 -0.400 0.000 0.000 0.000 -0.900 0.000 0.000 -0.800 0.000 0.000 0.000 0.000 -1.600 -0.800 0.000 -1.000 0.000 0.00
2300 -3.300 -8.100 0.000 0.000 -3.200 0.000 -2.900 0.000 0.000 -0.700 0.000 0.000 -1.000 -3.500 0.000 -2.400 -1.400 -0.
231500 0.000 0.000 0.000 0.000 0.000 0.000 -3.900 0.000 0.000 -4.100 0.000 0.000 0.000 0.000 0.000 -0.500 0.000 0.000 0
232.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.800 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0
233.000 0.000 0.000 -1.000 -0.500 0.000 -1.000 -0.700 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 -0.800 0.000 0.000 0.0
23400 0.000 0.000 0.000 0.000 0.000 -1.000 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.0
23500 -4.600 0.000 0.000 -0.700 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 -1.400 0.000 0
236.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.900 0.000 0.000 -3.100 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000
2370.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.
238000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.000 0.000 -0.800 0.000 -1.000 0.000 0.000 -3.300 -2.300 0.000
239 0.000 -2.300 0.000 0.000 -2.300 0.000 0.000 0.000 0.000 0.000 -2.300 0.000 -0.300 0.000 0.000 0.000 -0.900 0.000 -0
240.500 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 -4.000 0.000 -1.000 0.000 0.000 -3.300
241 0.000 0.000 0.000 0.000 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 0.000 0.000 0.000
242 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 0.000 0.000 -1.000 0.000 -1.000 -2.900 0.000 -2.400 -3.100 0
243.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.900 -0.500
2440.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -4.900 0.000 0.000 -1.000 0.000 0.000 0.000 0.000 0.000 0.000
2450.000 0.000 -0.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 -4.000 -1.000 -1.400 0.000 -2.
246400 -3.700 -3.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.500 0.000 0.000 0.000 -0.800 0.000 0.000 0.000 -0.900
247 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.800 0.000 0.000
2480.000 0.000 0.000 -0.000 -4.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000 0.0
24900 0.000 0.000 -1.700 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 -0.900 0.000 0.000 0.000 -0.200 0.000 0.000 0
250.000 0.000 -0.300 -1.400 0.000 0.000 0.000 0.000 -0.500 -0.800 0.000 -1.700 0.000 0.000 -4.700 0.000 0.000 -0.800 0.
251000 0.000 -0.800 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 0.000 0.000 -0.900 0.000 -0.800 0.000 0.000 -1.700 0.000
252 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 -0.800 0.000 -0.700 -1.700 0.000 -3.000 0.000 0.000 0.000 -0.300
253-0.500 0.000 0.000 0.000 0.000 -0.900 0.000 -0.400 0.000 0.000 0.000 0.000 0.000 0.000 -1.000 -0.500 0.000 -1.000 -0
254.700 -1.400 -3.100 0.000 -2.800 -1.400 0.000 -2.700 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.00
2550 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -2.300 0.000 0.000 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.00
2560 0.000 0.000 0.000 0.000 0.000 0.000 -4.000 0.000 0.000 0.000 0.000 0.000 -0.200 0.000 0.000 0.000 0.000 0.000 0.00
2570 0.000 0.000 -1.000 -1.400 -5.500 0.000 -2.800 -1.400 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0
258.000 0.000 0.000 0.000 0.000 0.000 0.000 -1.800 0.000 0.000 -1.800 0.000 0.000 -0.500 -0.800 0.000 -0.700 0.000 0.00
2590 -3.000 -1.000 0.000 0.000 -1.000 0.000 -0.500 -4.000 0.000 -0.700 0.000 0.000 -3.000 0.000 0.000 -0.300 0.000 0.00
2600 0.000 -0.900 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 -0.300 0.000 -1.400 0.000 -0.000 0.000 0.000 0.000 0.
261000 0.000 -1.500 0.000 -1.800 -3.500 0.000"])
262ghci> :r
263[2 of 9] Compiling GeneInput        ( GeneInput.hs, interpreted )
264Ok, modules loaded: AminoAcids, TRNA, Utilities, Options, Iterators, InputHandlers, OutputHandlers, GeneInput, Main.
265
266ghci> peels <- fmap ((diceAt '>') . lines) $ readFile "inputs\\energies.fasta"
267ghci> let peel1 = head peel1
268
269<interactive>:1:12:
270    Occurs check: cannot construct the infinite type: a = [a]
271      Expected type: [a]
272      Inferred type: a
273    In the expression: head peel1
274    In the definition of `peel1': peel1 = head peel1
275ghci> let peel1 = head peels
276ghci> :t peel1
277peel1 :: (String, [String])
278ghci> :t joinEng peel1
279joinEng peel1 :: (String, [Double])
280ghci> :r
281[9 of 9] Compiling Main             ( importer.hs, interpreted )
282Ok, modules loaded: AminoAcids, TRNA, Utilities, Options, Iterators, InputHandlers, OutputHandlers, GeneInput, Main.
283
284ghci> (genelist,opts) <- (readFile "inputs\\genes.fasta") (reaSegmentation fault/access violation in generated code
285
286C:\Users\Daniel\Programming\Genetics\GSPtools\Haskell>ghci
287GHCi, version 6.12.3: http://www.haskell.org/ghc/  :? for help
288Loading package ghc-prim ... linking ... done.
289Loading package integer-gmp ... linking ... done.
290Loading package base ... linking ... done.
291Loading package ffi-1.0 ... linking ... done.
292ghci> (genelist,opts) <- readFile "inputs\\
293appProperties       big_energies.fasta  big_genes.fasta     energies.fasta      genes.fasta
294ghci> (genelist,opts) <- readFile "inputs\\genes.fasta") rea
295read        readFile    readIO      readList    readLn      readParen   reads       readsPrec   realToFrac
296ghci> (genelist,opts) <- (readFile "inputs\\genes.fasta") (rea
297read        readFile    readIO      readList    readLn      readParen   reads       readsPrec   realToFrac
298ghci> (genelist,opts) <- (readFile "inputs\\genes.fasta") (rea
299read        readFile    readIO      readList    readLn      readParen   reads       readsPrec   realToFrac
300ghci>